View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6261_high_14 (Length: 248)
Name: NF6261_high_14
Description: NF6261
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6261_high_14 |
 |  |
|
| [»] chr2 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 230; Significance: 1e-127; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 7 - 248
Target Start/End: Complemental strand, 2355478 - 2355237
Alignment:
| Q |
7 |
agcagagaattgcagaaaaactgaaggctgaggtgaggtcagctcattgattttacaataaaatttcatactatttagctgctactaatcacatatgaag |
106 |
Q |
| |
|
|||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2355478 |
agcagagaattgaagaaaaactgaaagctgaggtgaggtcagctcattgattttacaataaaatttcatactatttagctgctactaatcacatatgaag |
2355379 |
T |
 |
| Q |
107 |
tgaaactagcaaattgatgtttaaattttgttatggttttgaagaggaagcagttggtgcaaggaatgaacttttaccttaaagttgttacatcaatccc |
206 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2355378 |
tgaaactagcaaattgatgtttgaattttgttatggttttgaagaggaagcagttggtgcaaggaatgaacttttaccttaaagttgttacatcaatccc |
2355279 |
T |
 |
| Q |
207 |
aggcattgacaatcacgatgcaaatgcggtaaatctctctac |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2355278 |
aggcattgacaatcacgatgcaaatgcggtaaatctctctac |
2355237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 7 - 135
Target Start/End: Original strand, 2222561 - 2222689
Alignment:
| Q |
7 |
agcagagaattgcagaaaaactgaaggctgaggtgaggtcagctcattgattttacaataaaatttcatactatttagctgctactaatcacatatgaag |
106 |
Q |
| |
|
|||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2222561 |
agcagagaattgaagaaaaactgaaagctgaggtgaggtcagctcattgattttacaataaaatttcatactatttagctgctactaatcacatatgaag |
2222660 |
T |
 |
| Q |
107 |
tgaaactagcaaattgatgtttaaatttt |
135 |
Q |
| |
|
|||||||||||||||||||||| |||||| |
|
|
| T |
2222661 |
tgaaactagcaaattgatgtttgaatttt |
2222689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University