View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6261_low_4 (Length: 459)
Name: NF6261_low_4
Description: NF6261
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6261_low_4 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 221; Significance: 1e-121; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 221; E-Value: 1e-121
Query Start/End: Original strand, 16 - 244
Target Start/End: Original strand, 6945995 - 6946223
Alignment:
| Q |
16 |
ctgtggagtttaatcctttggtgaaatagttgattgttggtcaatcttctgggatgtagttcatggtgccttttctctggcttgataggagttgtagaga |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6945995 |
ctgtggagtttaatcctttggtgaaatagttgattgttggtcaatcttctgggatgtagttcatggtgccttttctctggcttgataggagttgtagaga |
6946094 |
T |
 |
| Q |
116 |
tgttacaattttggaaaggctcttggttggatctttggtgttggtgaagtataattctgaggtatgttaattgcattgttgagtcgtcttggttgtatct |
215 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6946095 |
tgttacaattttgaaaaggctcttggttggatctttggtgttggtgaagtataattctgaggtatgttaattgcattgttgagtcgtcttggttgtatct |
6946194 |
T |
 |
| Q |
216 |
caatatccttgtcatgttggctgcgaaat |
244 |
Q |
| |
|
|||||||||| |||||||||||||||||| |
|
|
| T |
6946195 |
caatatccttatcatgttggctgcgaaat |
6946223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University