View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6264-Insertion-10 (Length: 191)
Name: NF6264-Insertion-10
Description: NF6264
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6264-Insertion-10 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 7 - 191
Target Start/End: Original strand, 11151569 - 11151753
Alignment:
| Q |
7 |
atgaacaatgtgaaaattgaaggcaagcctagagctatactgatgttcggtgcttgtaaatatatggttcgacaactacaatctgaacacctttcagata |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
11151569 |
atgaacaatgtgaaaattgaaggcaagcctagagctataccgatgttcggtgcttgtaaatatatggttcgacaactacaatctgaacaccttttagata |
11151668 |
T |
|
| Q |
107 |
atagaatatgaaatctgtcaaatcccacataagatcattttataagtaaaatatagtgtatagattgacacatttcggattatat |
191 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||| |
|
|
| T |
11151669 |
atagaatatgaaatctgtcaaaccccacataagatcattttataagtaaaatatagtgtatagatagacacattttggattatat |
11151753 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University