View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6264-Insertion-12 (Length: 189)
Name: NF6264-Insertion-12
Description: NF6264
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6264-Insertion-12 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
| [»] scaffold0183 (1 HSPs) |
| | |
|
Alignment Details
Target: chr6 (Bit Score: 178; Significance: 3e-96; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 178; E-Value: 3e-96
Query Start/End: Original strand, 8 - 189
Target Start/End: Complemental strand, 13779043 - 13778862
Alignment:
| Q |
8 |
caaagtaactctggttagtttctatgttctccaggacaccatcttctttccaaagattgagcctttgatgcatggttggagggacaactccgtcaacatg |
107 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13779043 |
caaagtaactctggttagtttctatgttttccaggacaccatcttctttccaaagattgagcctttgatgcatggttggagggacaactccgtcaacatg |
13778944 |
T |
|
| Q |
108 |
tatccattcccttcccatgagtaaattgtagttggctttagaagcaaccacccggaaaagtgttgatcttttcacagtacct |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13778943 |
tatccattcccttcccatgagtaaattgtagttggctttagaagcaaccacccggaaaagtgttgatcttttcacagtacct |
13778862 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0183 (Bit Score: 59; Significance: 3e-25; HSPs: 1)
Name: scaffold0183
Description:
Target: scaffold0183; HSP #1
Raw Score: 59; E-Value: 3e-25
Query Start/End: Original strand, 9 - 179
Target Start/End: Original strand, 12442 - 12612
Alignment:
| Q |
9 |
aaagtaactctggttagtttctatgttctccaggacaccatcttctttccaaagattgagcctttgatgcatggttggagggacaactccgtcaacatgt |
108 |
Q |
| |
|
||||||||| |||| || ||||||||| |||| |||||||||||||||||||| |||| ||||||||||| |||| ||||||||| || || ||||| |
|
|
| T |
12442 |
aaagtaactttggtcagcttctatgttttccaatacaccatcttctttccaaagggtgagtctttgatgcatagttgaagggacaacaccaacaccatgt |
12541 |
T |
|
| Q |
109 |
atccattcccttcccatgagtaaattgtagttggctttagaagcaaccacccggaaaagtgttgatctttt |
179 |
Q |
| |
|
||||| || ||||| | | ||||| ||||| ||||| |||| ||| ||| ||||||||||||||||||| |
|
|
| T |
12542 |
atccactctcttcctagtaacaaattatagttagctttcgaagaaactaccaggaaaagtgttgatctttt |
12612 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University