View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6264-Insertion-13 (Length: 231)
Name: NF6264-Insertion-13
Description: NF6264
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6264-Insertion-13 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 7 - 231
Target Start/End: Original strand, 36825741 - 36825965
Alignment:
| Q |
7 |
aggttgcgtggaagatatattcaatgtattacaatattggaaatctcgtaagtataatcagcaaaacaactggcttcaaacttggttaagacgggaaatt |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36825741 |
aggttgcgtggaagatatattcaatgtattacaatattggaaatctcgtaagtataatcagcaaaacaactggcttcaaacttggttaagacgggaaatt |
36825840 |
T |
|
| Q |
107 |
caagctcttacccaggttagttaatttgtcagattagtggcttgttagtgtattcgctttcatgtcggtgtaaattgttcacatcctaaccagttatata |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36825841 |
caagctcttacccaggttagttaatttgtcagattagtggcttgttagtgtattcgctttcatgtcggtgtaaattgttcacatcctaaccagttatata |
36825940 |
T |
|
| Q |
207 |
ctatgtggattcacatcatgttgca |
231 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
36825941 |
ctatgtggattcacatcatgttgca |
36825965 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University