View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6264-Insertion-7 (Length: 284)
Name: NF6264-Insertion-7
Description: NF6264
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6264-Insertion-7 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 126; Significance: 5e-65; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 126; E-Value: 5e-65
Query Start/End: Original strand, 8 - 133
Target Start/End: Original strand, 4736449 - 4736574
Alignment:
| Q |
8 |
gaaggtgctaagggaaagtagtgcaactggaggtcaatgtagcattgctgtacatgctgcttatcctactatatagtactactttttgatgaattttata |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4736449 |
gaaggtgctaagggaaagtagtgcaactggaggtcaatgtagcattgctgtacatgctgcttatcctactatatagtactactttttgatgaattttata |
4736548 |
T |
 |
| Q |
108 |
atatgatgtaataataagaataagtt |
133 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
4736549 |
atatgatgtaataataagaataagtt |
4736574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 103; E-Value: 3e-51
Query Start/End: Original strand, 174 - 284
Target Start/End: Original strand, 4736557 - 4736667
Alignment:
| Q |
174 |
taataataagaataagtttcctttattgtccttaatacggagaagatttgaaatgcaatgaaaaaagctcctcaagttgtacagagtacagacccgtgtg |
273 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
4736557 |
taataataagaataagtttcctttgttgtccttaatacggagaagatttgaaatgcaatgaaaaaagctcctcaagttgtagagagtacagacccgtgtg |
4736656 |
T |
 |
| Q |
274 |
attcgtcctag |
284 |
Q |
| |
|
||||||||||| |
|
|
| T |
4736657 |
attcgtcctag |
4736667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University