View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6264_high_26 (Length: 314)
Name: NF6264_high_26
Description: NF6264
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6264_high_26 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 245; Significance: 1e-136; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 20 - 313
Target Start/End: Complemental strand, 43780201 - 43779908
Alignment:
| Q |
20 |
aatattattgagaacatagcataaaaaattaaaagaaatattcaaaggggaaactccacagaaacacagttaaagatctcacgtccaaaccggatcactt |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43780201 |
aatattattgagaacatagcataaaaaattaaaagaaatattcaaagggaaaactccacagaaacacagttaaagatctcacgtccaaaccggatcactt |
43780102 |
T |
 |
| Q |
120 |
agtggctgagcacggctatttttgtcaaactctggatactgcagtaacggaggcattatgacttcagactctgtatatatctcacattccattgcctgca |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43780101 |
agtggctgagcacggctatttttgtcaaactctggatactgcagtaacggaggcattatgacttcagactctgtatatatctcacattccattgcctgca |
43780002 |
T |
 |
| Q |
220 |
tgtcagatgacatattcgaaggatctttaggtgattcaggctgctttnnnnnnncattttcgttctcaaggaatggcaatatattctcagtgtt |
313 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||| ||||| ||| |||||||||| |
|
|
| T |
43780001 |
tgtcagatgacatattcgaaggatctttaggtgattcaggctgcttgcaaaaaacattttcattctcaaggattggcagtatcatctcagtgtt |
43779908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University