View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6264_high_41 (Length: 248)
Name: NF6264_high_41
Description: NF6264
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6264_high_41 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 17 - 239
Target Start/End: Original strand, 54361334 - 54361552
Alignment:
| Q |
17 |
agataatagattgcattatctattcggtgaatctagataatagatcgtattacctattcagatatcgattgatgaatccatgcaagaatcataatattgc |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
54361334 |
agataatagattgcattatctattcggtgaatctagataatagatcgtattacctattcagatagcgattgatgaatccatgcaagaatcataatattgc |
54361433 |
T |
|
| Q |
117 |
atcggatccacggagcatacatatgatcataaattgagggtttgggaagacttttcgtcaatgannnnnnnnnnnnngttcttcgaaatcaatgctatgt |
216 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||| |
|
|
| T |
54361434 |
atcggatccacggagcatacaaatgatcataaattgagggtttgggaagac-tttcgtcaatga-ttttttttttttgttcttcgaaatcaatgctatgt |
54361531 |
T |
|
| Q |
217 |
gcattgatcttgctcctcctatg |
239 |
Q |
| |
|
||||||||| |||||||||||| |
|
|
| T |
54361532 |
gcattgatc--gctcctcctatg |
54361552 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University