View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6264_low_20 (Length: 370)
Name: NF6264_low_20
Description: NF6264
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6264_low_20 |
 | |
|
| [»] scaffold0004 (1 HSPs) |
| |
|
Alignment Details
Target: scaffold0004 (Bit Score: 347; Significance: 0; HSPs: 1)
Name: scaffold0004
Description:
Target: scaffold0004; HSP #1
Raw Score: 347; E-Value: 0
Query Start/End: Original strand, 12 - 370
Target Start/End: Original strand, 374107 - 374465
Alignment:
| Q |
12 |
agagaggggtagcagtagcaataaactcattggaataaggttccttgagtatgtaaaaggaagtcctgtttcccacaaaacccaccaagcaattgttctg |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
374107 |
agagaggggtagcagtagcaataaactcattggaataaggttccttgagtatgtaaaaggaagtcctgtttcccacaaaacccaccaagcaattgttctg |
374206 |
T |
|
| Q |
112 |
attgtaacatttctagcttatgctagttatcacgcaactagaaaaaccactagtattgtaaagagtgttcttgatccccaatcatcttcaacaaatttag |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
374207 |
attgtaacatttctagcttatgctagttatcacgccactagaaaaaccactagtattgtgaagagtgtgcttgatccccaatcatcttcaacaaatttag |
374306 |
T |
|
| Q |
212 |
gcttcaatttctttccttcgagtacgagggttacaaaactttcttggaaacttggagatggctgggctccatttaatggatccgacgggacatcccttct |
311 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
374307 |
gcttcaatttctttccttcgagtacgagggttacaaaactttcttggaaacttggagatggctgggctccatttaatggatccgacgggacatcccttct |
374406 |
T |
|
| Q |
312 |
tggccaattggatgttgcttttctcgcagtttatgcatttgggatgtacttttctggac |
370 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
374407 |
tggccaattggatgttgcttttctcgcagtttatgcatttgggatgtacttttctggac |
374465 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University