View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6264_low_31 (Length: 302)
Name: NF6264_low_31
Description: NF6264
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6264_low_31 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 79; Significance: 6e-37; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 79; E-Value: 6e-37
Query Start/End: Original strand, 170 - 287
Target Start/End: Original strand, 27763821 - 27763941
Alignment:
| Q |
170 |
aagtaaagaagcaaactaagactacattttatacat---ataaacaaggttttaaatcgcagtcgcgctcacatctagggttgcattatgatctttgatt |
266 |
Q |
| |
|
||||||||||||||||||||| || |||||||||| ||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
27763821 |
aagtaaagaagcaaactaagattaaattttatacaacaaataaacaaggttttaaatcatagtcgtgctcacatctagggttgcattatgatctttgatt |
27763920 |
T |
 |
| Q |
267 |
atcgcagttgaaattatgtta |
287 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
27763921 |
gtcgcagttgaaattatgtta |
27763941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 12 - 96
Target Start/End: Original strand, 27763723 - 27763802
Alignment:
| Q |
12 |
atgaagtactagaataaagtagtatttaaattaactctttatgaccatcaatgaggtgggaatccaaaacatgcacaaatatgct |
96 |
Q |
| |
|
||||||||||| |||||| |||||||||| | |||||||| |||||||||||| | |||||||||||||||||||||||| |
|
|
| T |
27763723 |
atgaagtactacaataaaatagtatttaa-----cactttatgattatcaatgaggtgtggatccaaaacatgcacaaatatgct |
27763802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University