View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6264_low_35 (Length: 278)
Name: NF6264_low_35
Description: NF6264
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6264_low_35 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 116; Significance: 5e-59; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 116; E-Value: 5e-59
Query Start/End: Original strand, 7 - 153
Target Start/End: Complemental strand, 44900614 - 44900467
Alignment:
| Q |
7 |
gctagttcaaaagaaatacct-aactctcagaatccttttaatgagatttatatttacaaatcatatgtttttggtgtaatgnnnnnnnnaatttgtcga |
105 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
44900614 |
gctagttcaaaagaaataccttaactctcagaatccttttaatgagatttatatttacaaatcatatgtttttggtgtaatgttttttttaatttgtcga |
44900515 |
T |
 |
| Q |
106 |
tgttagtcttttatcccacttattgttgctgtcaatttcgtcaaggta |
153 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44900514 |
tgttagtcttttatcccacttattgttgctgtcaatttcgtcaaggta |
44900467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 231 - 278
Target Start/End: Complemental strand, 44900391 - 44900344
Alignment:
| Q |
231 |
acaatttagtatctaattttgtttgatatatcctattggactgtcaat |
278 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44900391 |
acaaattagtatctaattttgtttgatatatcctattggactgtcaat |
44900344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University