View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6264_low_54 (Length: 207)

Name: NF6264_low_54
Description: NF6264
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6264_low_54
NF6264_low_54
[»] chr1 (1 HSPs)
chr1 (18-192)||(42125698-42125875)


Alignment Details
Target: chr1 (Bit Score: 127; Significance: 9e-66; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 127; E-Value: 9e-66
Query Start/End: Original strand, 18 - 192
Target Start/End: Original strand, 42125698 - 42125875
Alignment:
18 tctatccaagaaaatattcaaaggtgannnnnnnn--aacgatgataaaaattaatttgaaatcaaattaaaatatttcaagaacctgaatttgggataa 115  Q
    |||||||||||||||||||||||||||          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42125698 tctatccaagaaaatattcaaaggtgattttttttttaacgatgataaaaattaatttgaaatcaaattaaaatatttcaagaacctgaatttgggataa 42125797  T
116 ttccagaaattactatg-ttttttagttcgagagacgattatgagtatgaaaggtgttaacaccttatgatatctgtg 192  Q
    ||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||    
42125798 ttccagaaattactatgtttttttaggtcgagagacgattatgagtatgaaaggtgttaacaccttataatatctgtg 42125875  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University