View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6265_low_11 (Length: 244)
Name: NF6265_low_11
Description: NF6265
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6265_low_11 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 161; Significance: 6e-86; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 161; E-Value: 6e-86
Query Start/End: Original strand, 17 - 234
Target Start/End: Complemental strand, 44798730 - 44798514
Alignment:
| Q |
17 |
atatatatattggtttatttatggtctcttaattctcaacaaaaatactcaattcgtgatgtatatcctttcagcctgcttatcctattggccagccaat |
116 |
Q |
| |
|
||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44798730 |
atatatatattggcttatttatggtctcttcattctcaacaaaaatactcaattcgtgatatatatcctttcagcctgcttatcctattggccagccaat |
44798631 |
T |
|
| Q |
117 |
ttatnnnnnnnnnnnntcatgagactatacattgtttggacttttcagggataagtacagtgaacaaaaataatttattttagcaaatagtcaaagaaca |
216 |
Q |
| |
|
|||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44798630 |
ttataaaaaaaaaaa-tcatgagacgatacattgtttggacttttcagggataagtacagtgaacaaaaataatttattttagcaaatagtcaaagaaca |
44798532 |
T |
|
| Q |
217 |
aaactcttaacacctatg |
234 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
44798531 |
aaactcttaacacctatg |
44798514 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University