View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6265_low_5 (Length: 326)
Name: NF6265_low_5
Description: NF6265
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6265_low_5 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 128; Significance: 4e-66; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 128; E-Value: 4e-66
Query Start/End: Original strand, 1 - 171
Target Start/End: Original strand, 7943842 - 7944002
Alignment:
| Q |
1 |
gatggagtttggctggagggaggatttggatatgtttggattttagatgtaaccatcaccattccattaaactggggtaaggtaaggtaaggtaaggtat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
7943842 |
gatggagtttggctggagggaggatttggatatgtttggattttagatgtaaccatcaccattccattaaactgg----------ggtaaggtaaggtat |
7943931 |
T |
 |
| Q |
101 |
gctatactatattctagatatctttcttataagattttattaaaaataattgtatctattttttatactat |
171 |
Q |
| |
|
|||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7943932 |
gctatactatattccagatatctttgttataagattttattaaaaataattgtatctattttttatactat |
7944002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 101; E-Value: 5e-50
Query Start/End: Original strand, 174 - 282
Target Start/End: Original strand, 7945332 - 7945440
Alignment:
| Q |
174 |
tccacgttggcattgatatctcttcaattttactttgacgtcttgattctatcgaagggattctgctcaatgtcaacttcattttgaatgattctagcat |
273 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
7945332 |
tccacgttggcattgatatctcttcaatattactttgacgtcttgattctatcgaagggattctgctcaatctcaacttcattttgaatgattctagcat |
7945431 |
T |
 |
| Q |
274 |
gttacttgg |
282 |
Q |
| |
|
||||||||| |
|
|
| T |
7945432 |
gttacttgg |
7945440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University