View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6266_high_5 (Length: 317)
Name: NF6266_high_5
Description: NF6266
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6266_high_5 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 252; Significance: 1e-140; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 22 - 311
Target Start/End: Complemental strand, 27742209 - 27741916
Alignment:
| Q |
22 |
cgtttttgacgtgggttctaaattattgcagccattttcaaccttatctctctgtcggtaatgataatagttcgtttggagtgaagtgggattgaaaatg |
121 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27742209 |
cgtttttgacgtggattctaaattattgcagccattttcacccttatctctctgtcggtaatgataatagttcgtttggagtgaagtgggattgaaaatg |
27742110 |
T |
 |
| Q |
122 |
tatttagagccacaaaaccattggagacatattctacttcaagatcaaatttgaacagtttttattacta---gctatagcaatttatagcatatagaca |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
27742109 |
tatttagagccacaaaaccattggagacatattctacttcaagatcaaatttgaacagtttttattactatttgctatagcaatttatagcatatagaca |
27742010 |
T |
 |
| Q |
219 |
tatataaatccttccaaatatagacaaacttcgcgttcctttcaatcatcattcttcaaagtttacatcgatcaatcttt-tcttcgaagaagc |
311 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||| |
|
|
| T |
27742009 |
tatataaatctttccaaatatagacaaacttcgtgttcctttcaatcatcattcttcaaagtttacatcgatcaatctttcttttcgaagaagc |
27741916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University