View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6266_high_6 (Length: 308)
Name: NF6266_high_6
Description: NF6266
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6266_high_6 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 261; Significance: 1e-145; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 261; E-Value: 1e-145
Query Start/End: Original strand, 22 - 306
Target Start/End: Complemental strand, 29769055 - 29768771
Alignment:
| Q |
22 |
aagtactcgcttccatcggaagctgccatttttgttttctctctctaacggattttgatttcgcttctgagaagaaggatgagagagtgagtgtatgttt |
121 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||| |
|
|
| T |
29769055 |
aagtactcgcttccatcggaagctgccatttttgttttctctctctaacggattttgatttcgcttctgagaagaagaatgagagagcgagtgtatgttt |
29768956 |
T |
 |
| Q |
122 |
gagtttttatgcttctgatggaatgaacggtggagggtggtgtgagatgacggaaatgccctccgtatttctcggtgaagttggttatggttttgggaaa |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
29768955 |
aagtttttatgcttctgatggaatgaacggtggagggtggtatgagatgacggaaatgccctccgtgtttctcggtgaagttggttatggttttgggaaa |
29768856 |
T |
 |
| Q |
222 |
agaaaagaagctgtcacttgtttttccaagtttgtgtgggtgactctgttgtgcatgggaattaagtgagatggctttgtcctat |
306 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
29768855 |
agaaaagaagctgtcacttgtttttccaagtttgtgtgggtgactctgttgtgcatgggaattaattgagatggctttgtcctat |
29768771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University