View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6266_low_11 (Length: 245)
Name: NF6266_low_11
Description: NF6266
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6266_low_11 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 19 - 245
Target Start/End: Complemental strand, 16956578 - 16956352
Alignment:
| Q |
19 |
cccttggggtactcccttttttgaactgaataagcactcacnnnnnnntatatatcacatgtggcgcttccgccattcggatggatttggtcttaagcta |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16956578 |
cccttggggtactcccttttttgaactgaataagcactcacaaaaaaatatatatcacatgtggcgcttccgccattcggatggatttggtcttaagcta |
16956479 |
T |
 |
| Q |
119 |
aatgatatatattgtttaacaccctaaaatgttaaattaattaatttgaaaattatctgaaaatgattttcttaatgcacacnnnnnnngtgagtttatc |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
16956478 |
aatgatatatattgtttaacaccctaaaatgttaaattaattaatttgaaaattatctgaaaatgattttcttaatgcacactttttttgtgagtttatc |
16956379 |
T |
 |
| Q |
219 |
tgctacaatagcttccgctaattttct |
245 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
16956378 |
tgctacaatagcttccgctaattttct |
16956352 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University