View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6266_low_12 (Length: 218)
Name: NF6266_low_12
Description: NF6266
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6266_low_12 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 53; Significance: 1e-21; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 25 - 101
Target Start/End: Complemental strand, 15233230 - 15233156
Alignment:
| Q |
25 |
taaggaaagtcttgagtaaagtcaaactaacaagtaaaaaacattaatttagcaattaattattgacatttatcgtt |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||| ||||||||| |||||||||||||||||||||||| |
|
|
| T |
15233230 |
taaggaaagtcttgagtaaagtcaaactaacaag-aaaaaaaattaattta-aaattaattattgacatttatcgtt |
15233156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University