View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6266_low_12 (Length: 218)

Name: NF6266_low_12
Description: NF6266
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6266_low_12
NF6266_low_12
[»] chr5 (1 HSPs)
chr5 (25-101)||(15233156-15233230)


Alignment Details
Target: chr5 (Bit Score: 53; Significance: 1e-21; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 25 - 101
Target Start/End: Complemental strand, 15233230 - 15233156
Alignment:
25 taaggaaagtcttgagtaaagtcaaactaacaagtaaaaaacattaatttagcaattaattattgacatttatcgtt 101  Q
    |||||||||||||||||||||||||||||||||| |||||| |||||||||  ||||||||||||||||||||||||    
15233230 taaggaaagtcttgagtaaagtcaaactaacaag-aaaaaaaattaattta-aaattaattattgacatttatcgtt 15233156  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University