View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6268_high_21 (Length: 249)
Name: NF6268_high_21
Description: NF6268
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6268_high_21 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 181; Significance: 7e-98; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 181; E-Value: 7e-98
Query Start/End: Original strand, 1 - 224
Target Start/End: Original strand, 12909647 - 12909864
Alignment:
| Q |
1 |
tcctgttgttgatgttgatgctgatgctgctgaatgaaaccgttgttagtgttgttgttgctttgaattggaaaccctaatcttcgtagatcttcagtga |
100 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12909647 |
tcctgttgttgatgttgatgctgttgctgctgaatgaaacc------attgttgttgttgctttgaattggaaaccctaatcttcgtagatcttcagtga |
12909740 |
T |
|
| Q |
101 |
gtgaagcaccattagcgttggtgaagtttgagtaatgagtttcctgtacccgttgaagtggaaacgggttatgggttaacccgaatacgtgaggagaagg |
200 |
Q |
| |
|
|||||||||| ||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12909741 |
gtgaagcaccgttagcgttggtgaagttggagtaatgagtttccggtacccgttgaagtggaaacgggttatgggttaacccgaatacgtgaggagaagg |
12909840 |
T |
|
| Q |
201 |
tgtgtgggaccatggtggaagatg |
224 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
12909841 |
tgtgtgggaccatggtggaagatg |
12909864 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 50 - 110
Target Start/End: Complemental strand, 12926065 - 12926005
Alignment:
| Q |
50 |
tgttgttgttgctttgaattggaaaccctaatcttcgtagatcttcagtgagtgaagcacc |
110 |
Q |
| |
|
||||| || |||||| |||||||||||||||||||| ||||| ||||| ||| ||| |||| |
|
|
| T |
12926065 |
tgttgctgctgctttcaattggaaaccctaatcttcttagatattcagcgagagaaacacc |
12926005 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University