View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6268_high_22 (Length: 220)
Name: NF6268_high_22
Description: NF6268
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6268_high_22 |
 |  |
|
| [»] scaffold0710 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0710 (Bit Score: 151; Significance: 5e-80; HSPs: 1)
Name: scaffold0710
Description:
Target: scaffold0710; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 1 - 151
Target Start/End: Original strand, 4608 - 4758
Alignment:
| Q |
1 |
ttcattgaaagttggtttagctttgacacttgtttcattgttgtatctaatggaaccattgtacaaagggataggaaaaaatgctgttgttgctgtcatg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4608 |
ttcattgaaagttggtttagctttgacacttgtttcattgttgtatctaatggaaccattgtacaaagggataggaaaaaatgctgttgttgctgtcatg |
4707 |
T |
 |
| Q |
101 |
actgtggttgtggtcatggagtttacagtaggtaggaaattttcatttctc |
151 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4708 |
actgtggttgtggtcatggagtttacagtaggtaggaaattttcatttctc |
4758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 151; Significance: 5e-80; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 1 - 151
Target Start/End: Original strand, 51860649 - 51860799
Alignment:
| Q |
1 |
ttcattgaaagttggtttagctttgacacttgtttcattgttgtatctaatggaaccattgtacaaagggataggaaaaaatgctgttgttgctgtcatg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51860649 |
ttcattgaaagttggtttagctttgacacttgtttcattgttgtatctaatggaaccattgtacaaagggataggaaaaaatgctgttgttgctgtcatg |
51860748 |
T |
 |
| Q |
101 |
actgtggttgtggtcatggagtttacagtaggtaggaaattttcatttctc |
151 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51860749 |
actgtggttgtggtcatggagtttacagtaggtaggaaattttcatttctc |
51860799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 13 - 134
Target Start/End: Complemental strand, 51756057 - 51755936
Alignment:
| Q |
13 |
tggtttagctttgacacttgtttcattgttgtatctaatggaaccattgtacaaagggataggaaaaaatgctgttgttgctgtcatgactgtggttgtg |
112 |
Q |
| |
|
|||||||| ||||||||||||||| ||||||||||| ||||| ||||||| ||||| ||| ||||| |||| ||| ||||||||||||||||||||||| |
|
|
| T |
51756057 |
tggtttagttttgacacttgtttccttgttgtatcttatggagccattgttcaaagtgatgggaaagaatgttgtggttgctgtcatgactgtggttgtt |
51755958 |
T |
 |
| Q |
113 |
gtcatggagtttacagtaggta |
134 |
Q |
| |
|
|||||||||||||| ||||||| |
|
|
| T |
51755957 |
gtcatggagtttactgtaggta |
51755936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 67; E-Value: 6e-30
Query Start/End: Original strand, 5 - 123
Target Start/End: Original strand, 51850206 - 51850324
Alignment:
| Q |
5 |
ttgaaagttggtttagctttgacacttgtttcattgttgtatctaatggaaccattgtacaaagggataggaaaaaatgctgttgttgctgtcatgactg |
104 |
Q |
| |
|
|||||||||||| | |||||||||||||| || ||||||||||||||||| ||||||| |||||||||||| |||||||| | ||||||||||||| |
|
|
| T |
51850206 |
ttgaaagttggtcttgctttgacacttgtatctttgttgtatctaatggagccattgttcaaagggataggggaaaatgctatgtgggctgtcatgactg |
51850305 |
T |
 |
| Q |
105 |
tggttgtggtcatggagtt |
123 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
51850306 |
tggttgtggtcatggagtt |
51850324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 6 - 135
Target Start/End: Original strand, 51820657 - 51820786
Alignment:
| Q |
6 |
tgaaagttggtttagctttgacacttgtttcattgttgtatctaatggaaccattgtacaaagggataggaaaaaatgctgttgttgctgtcatgactgt |
105 |
Q |
| |
|
||||||||||| | ||||| |||| || || ||| |||||||||||||||| |||| ||||||||||||| ||||||| | |||||||||||||| |
|
|
| T |
51820657 |
tgaaagttggtcttgctttagcactagtatctttgctgtatctaatggaacctttgttcaaagggataggatcaaatgctatgtgggctgtcatgactgt |
51820756 |
T |
 |
| Q |
106 |
ggttgtggtcatggagtttacagtaggtag |
135 |
Q |
| |
|
|||||||||||||||||| || |||||||| |
|
|
| T |
51820757 |
ggttgtggtcatggagttcactgtaggtag |
51820786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University