View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6268_high_23 (Length: 219)
Name: NF6268_high_23
Description: NF6268
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6268_high_23 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 177; Significance: 1e-95; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 18 - 198
Target Start/End: Complemental strand, 28023618 - 28023438
Alignment:
| Q |
18 |
aggttatgcatttcagtttatatggttgtgtcagaaacttttttctggctactttttgaactgtagtacctagatcgagtttttaaaggtgaattaaaca |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28023618 |
aggttatgcatttcagtttatatggttgtgtcacaaacttttttctggctactttttgaactgtagtacctagatcgagtttttaaaggtgaattaaaca |
28023519 |
T |
|
| Q |
118 |
ctaaactgctgcagttgaggacaaatcagagggcctaatggctgacagctgcggaagagatcgaagtattaaacaggcgag |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28023518 |
ctaaactgctgcagttgaggacaaatcagagggcctaatggctgacagctgcggaagagatcgaagtattaaacaggcgag |
28023438 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University