View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6268_low_22 (Length: 249)

Name: NF6268_low_22
Description: NF6268
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6268_low_22
NF6268_low_22
[»] chr8 (2 HSPs)
chr8 (1-224)||(12909647-12909864)
chr8 (50-110)||(12926005-12926065)


Alignment Details
Target: chr8 (Bit Score: 181; Significance: 7e-98; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 181; E-Value: 7e-98
Query Start/End: Original strand, 1 - 224
Target Start/End: Original strand, 12909647 - 12909864
Alignment:
1 tcctgttgttgatgttgatgctgatgctgctgaatgaaaccgttgttagtgttgttgttgctttgaattggaaaccctaatcttcgtagatcttcagtga 100  Q
    ||||||||||||||||||||||| |||||||||||||||||      | |||||||||||||||||||||||||||||||||||||||||||||||||||    
12909647 tcctgttgttgatgttgatgctgttgctgctgaatgaaacc------attgttgttgttgctttgaattggaaaccctaatcttcgtagatcttcagtga 12909740  T
101 gtgaagcaccattagcgttggtgaagtttgagtaatgagtttcctgtacccgttgaagtggaaacgggttatgggttaacccgaatacgtgaggagaagg 200  Q
    |||||||||| ||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
12909741 gtgaagcaccgttagcgttggtgaagttggagtaatgagtttccggtacccgttgaagtggaaacgggttatgggttaacccgaatacgtgaggagaagg 12909840  T
201 tgtgtgggaccatggtggaagatg 224  Q
    ||||||||||||||||||||||||    
12909841 tgtgtgggaccatggtggaagatg 12909864  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 50 - 110
Target Start/End: Complemental strand, 12926065 - 12926005
Alignment:
50 tgttgttgttgctttgaattggaaaccctaatcttcgtagatcttcagtgagtgaagcacc 110  Q
    ||||| || |||||| |||||||||||||||||||| ||||| ||||| ||| ||| ||||    
12926065 tgttgctgctgctttcaattggaaaccctaatcttcttagatattcagcgagagaaacacc 12926005  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University