View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6268_low_25 (Length: 204)
Name: NF6268_low_25
Description: NF6268
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6268_low_25 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 19 - 184
Target Start/End: Complemental strand, 11142277 - 11142112
Alignment:
| Q |
19 |
caaccgatatcaaggcatgtgcaagttgttgtggctaaaaatcatcgtagatgacttgaaagtcaaattgtaataacattttgggtagtttacacaatgc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
11142277 |
caaccgatatcaaggcatgtgcaagttgttgtggctaaaaatcatcttagatgacttgaaagtcaacttgtaataacattttgggtagtttacacaatgc |
11142178 |
T |
 |
| Q |
119 |
ataagagacaagtagtttcttaaagaaatacttcaatacaaaacgtagttcctaaaaagtagctag |
184 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||| |
|
|
| T |
11142177 |
ataagagacaagtagtttcttaaagaaatacttcaatacaacacgtagttcctaaaaagcagctag |
11142112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University