View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6269_low_2 (Length: 236)
Name: NF6269_low_2
Description: NF6269
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6269_low_2 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 95; Significance: 1e-46; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 46 - 223
Target Start/End: Complemental strand, 10582095 - 10581920
Alignment:
| Q |
46 |
gttctaagataaatattgatgaatattcagaatttattaagaagactaga-tgaagaatgcatattttagtagatcaagtccttcgattgaagaatacaa |
144 |
Q |
| |
|
||||||||||||||||||||||||||||| | | | ||| |||| ||| ||||||| |||||||||||||||||||||||| || |||||||| ||| |
|
|
| T |
10582095 |
gttctaagataaatattgatgaatattcacagtgcttgaag-agac-agagcgaagaatacatattttagtagatcaagtcctttgagtgaagaatgcaa |
10581998 |
T |
 |
| Q |
145 |
aatctctctgcaaggagaggtctagatgtagcaacaagttgttttgagttagtataaacatatttgtttgttattcttg |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| || ||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
10581997 |
aatctctctgcaaggagaggtctagatgtagcaaaaatttgttttgagttagtat-aacatatttgtttgttattcttg |
10581920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University