View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6272_high_11 (Length: 250)
Name: NF6272_high_11
Description: NF6272
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6272_high_11 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 16 - 241
Target Start/End: Original strand, 53042850 - 53043075
Alignment:
| Q |
16 |
aatggagtggaaaatagtaacgatagatatcgcgggagaatatctctgcctagatttagaagtaggtatgtattactgcatgtagaatcacggaaatacc |
115 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53042850 |
aatggagtggaaaatggtaacgatagatatcgcgggagaatatctctgcctagatttagaagtaggtatgtattactgcatgtagaatcacggaaatacc |
53042949 |
T |
 |
| Q |
116 |
ctttatgaagttggatgtgttgtgttttgtcggtggattttgaggggtacaatgataaaagaagggagtcaaaagattgactgatgctagcttcgtcggt |
215 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53042950 |
ctttatgaagttggataggttgtgttttgtcggtggattttgaggggtataatgataaaagaagggagtcaaaagattgactgatgctagcttcgtcggt |
53043049 |
T |
 |
| Q |
216 |
gggattgttaatgatttggacctttg |
241 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
53043050 |
gggattgttaatgatttggacctttg |
53043075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University