View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6272_high_12 (Length: 228)
Name: NF6272_high_12
Description: NF6272
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6272_high_12 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 130; Significance: 2e-67; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 1 - 142
Target Start/End: Complemental strand, 53042410 - 53042269
Alignment:
| Q |
1 |
tatgccggtaagaagaaaatcgctaacgcgaattccgataaacccgaaccggttcccggtcctcctggtgctattgatcaaaaatatgcttctgctctca |
100 |
Q |
| |
|
||||||| |||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53042410 |
tatgccgttaagaagaaaatcgataactcgaattccgataaacccgaaccggttcccggtcctcctggtgctattgatcaaaaatatgcttctgctctca |
53042311 |
T |
 |
| Q |
101 |
aaactgcaatgcaattcttcgacgtgcaaaaatgtaatattc |
142 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53042310 |
aaactgcaatgcaattcttcgacgtgcaaaaatgtaatattc |
53042269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 180 - 213
Target Start/End: Complemental strand, 53042231 - 53042198
Alignment:
| Q |
180 |
acaatgtggttgatttattgtaggaagatattag |
213 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||| |
|
|
| T |
53042231 |
acaatgtgtttgatttattgtaggaagatattag |
53042198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University