View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6272_low_17 (Length: 211)
Name: NF6272_low_17
Description: NF6272
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6272_low_17 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 153; Significance: 3e-81; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 15 - 196
Target Start/End: Original strand, 39002461 - 39002642
Alignment:
| Q |
15 |
aaaaacaacaactaaagaggggaatattgaaaagggaagnnnnnnntcacatcactttcaaattgtttcatgcatgcattaattatgaatagcattagca |
114 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39002461 |
aaaaacaacaacaaaagaggggaatattgaaaagggaaaaaaaaaatcacatcactttcaaattgtttcatgcatgcattaattatgaatagcattagca |
39002560 |
T |
 |
| Q |
115 |
agatgatttttcttccatttcaccgtggagtggagcacaactgtcacaccttacctaccaacaatcccacttacttcctttg |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39002561 |
agatgatttttcttccatttcaccgtggagtggagcacaactgtcacaccttacctaccaacaatcccacttacttcctttg |
39002642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 61 - 119
Target Start/End: Original strand, 39002909 - 39002967
Alignment:
| Q |
61 |
tcacatcactttcaaattgtttcatgcatgcattaattatgaatagcattagcaagatg |
119 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39002909 |
tcacatcactttcaaattgcaccatgcatgcattaattatgaatagcattagcaagatg |
39002967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University