View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6273_high_12 (Length: 304)
Name: NF6273_high_12
Description: NF6273
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6273_high_12 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 269; Significance: 1e-150; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 269; E-Value: 1e-150
Query Start/End: Original strand, 17 - 293
Target Start/End: Original strand, 33032833 - 33033109
Alignment:
| Q |
17 |
atcaagttggcttgtaacttcagattcatattctgcacaagcttctacttcaagatcaatgttttgtttcatgctttagcagtgaaaattttattttgtc |
116 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33032833 |
atcaacttggcttgtaacttcagattcatattctgcacaagcttctacttcaagatcaatgttttgtttcatgctttagcagtgaaaattttattttgtc |
33032932 |
T |
 |
| Q |
117 |
ctgcaattaggataacctatgagctcatatgaagatatcatgaaaacaagaaattattgtgttagtgaacataatcatcctatgatttgtctcctttgtg |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33032933 |
ctgcaattaggataacctatgagctcatatgaagatatcatgaaaacaagaaattattgtgttagtgaacataatcatcctatgatttgtctcctttgtg |
33033032 |
T |
 |
| Q |
217 |
aaagacaattagtcttggcatagatacacatttatgtaccatgttttttgatttaattacataatcatcctatgcta |
293 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33033033 |
aaagacaattagtcttggcatagatacacatttatttaccatgttttttgatttaattacataatcatcctatgcta |
33033109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University