View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6273_high_16 (Length: 253)
Name: NF6273_high_16
Description: NF6273
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6273_high_16 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 130; Significance: 2e-67; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 24 - 252
Target Start/End: Complemental strand, 25582043 - 25581817
Alignment:
| Q |
24 |
atcactcccatgcataacctatcaacagttatttggatataaatctcaatcacatttagtaagatcttaaagtccagcaatgacaatgatgggcagtgtg |
123 |
Q |
| |
|
|||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25582043 |
atcactcctatgcataacctatcaacagtgatttggatataaatctcaatcacatttagtaagatcttaaagtccagcaatgacaatgatgggcagtgtg |
25581944 |
T |
 |
| Q |
124 |
aaagnnnnnnnntcaccatagtagaatcaccttcatatc-tttagattaattgttatgccctaactacgtcaa-nnnnnnnatgcatacattcaatcaaa |
221 |
Q |
| |
|
||| |||||||||||| |||||||||||||| ||||||||||||||||||| ||||||||||||| | ||||||||||||| ||| |
|
|
| T |
25581943 |
aaa----aaaaatcaccatagtaggatcaccttcatatcttttagattaattgttatgcactaactacgtcaattttttgtacgcatacattcaattaaa |
25581848 |
T |
 |
| Q |
222 |
tcatgttaaaaagatgaagttagctctcaaa |
252 |
Q |
| |
|
||| ||||||||||||||||||| ||||||| |
|
|
| T |
25581847 |
tcacgttaaaaagatgaagttagttctcaaa |
25581817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University