View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6273_high_26 (Length: 228)
Name: NF6273_high_26
Description: NF6273
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6273_high_26 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 1 - 228
Target Start/End: Original strand, 1223117 - 1223351
Alignment:
| Q |
1 |
acttgaatcagaaaaggtattaaaaagtgagtttgatatacttgaatatgttcagaatctgctggaattcagaatcccctggaaacaaagcctgtcttct |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1223117 |
acttgaatcagaaaaggtattaaaaagtgagtttgatatacttgaatatgttcagaagctgctggaattcagaatcccctggaaacaaagcctgtcttct |
1223216 |
T |
 |
| Q |
101 |
caccatttcagctgcacnnnnnnncaaattcaattacattccatcatatataaagaaagaa-------aagtatcaaaatcaccaacataaagagttgct |
193 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
1223217 |
caccatttcagctgcacaaaaaaacaaattcaattacattccatcatatataaagaaagaaaagtatcaagtatcaaaatcaccaacataaagagttgcc |
1223316 |
T |
 |
| Q |
194 |
ccaactcgatgcccttaatttgattcctagagtca |
228 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||| |
|
|
| T |
1223317 |
ccaacacgatgcccttaatttgattcctagagtca |
1223351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University