View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6273_low_24 (Length: 240)

Name: NF6273_low_24
Description: NF6273
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6273_low_24
NF6273_low_24
[»] chr4 (1 HSPs)
chr4 (19-240)||(1223387-1223608)


Alignment Details
Target: chr4 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 19 - 240
Target Start/End: Complemental strand, 1223608 - 1223387
Alignment:
19 gatccaccgtaattaggatcttggacccaccatagtgctaaaatgtagcggtgctattgttacatgatgcattatttcgagtgaaatgttgtcgaatagc 118  Q
    ||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||    
1223608 gatccaccgtaattaggatcttggacccaccatagcgctaaaatgtagtggtgctattgttacatgatgcattatttcgagtgaaatgttgtcgaatagc 1223509  T
119 agctatagaggcgcaatagcgtgtaatgtagtttgaacaaactattgttttttgtgatctgcgattgacaacacttgttattggattaatttcttgagtc 218  Q
    |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1223508 agctatagaggcgcaatagcgtgtaatgtagtttgatcaaactattgttttttgtgatctgcgattgacaacacttgttattggattaatttcttgagtc 1223409  T
219 ggttgtgcaacatcggtttctt 240  Q
    ||||||||||||||||||||||    
1223408 ggttgtgcaacatcggtttctt 1223387  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University