View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6273_low_9 (Length: 355)
Name: NF6273_low_9
Description: NF6273
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6273_low_9 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 299; Significance: 1e-168; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 299; E-Value: 1e-168
Query Start/End: Original strand, 18 - 345
Target Start/End: Original strand, 33847367 - 33847694
Alignment:
| Q |
18 |
atatatgcaaagagtgttactactatgataatataaaattgcaaaaatagaggatcnnnnnnnggttggtacttttaaggtagcaatttgatgattcatc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33847367 |
atatatgcaaagagtgttactactatgataatataaaattgcaaaaatagaggatctttttttggttggtacttttaaggtagcaatttgatgattcatc |
33847466 |
T |
 |
| Q |
118 |
ttcggcgctgttaacgggtttagatgattttgtagttgcttcaaactaaagttatactatgacatgcctgctataaatttaattttgtatatctataata |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33847467 |
ttcggcgctgttaacgggtttagatgattttgtagttgcttcaaactaaagttatactatgacatgcctgctataaatttaattttgtatatctataata |
33847566 |
T |
 |
| Q |
218 |
atcacataccatattaaagtgaaattttatgttgctttgtattctttttgacttgtatactatgccccttaaatgtagtcatatatggactttgtcttcc |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
33847567 |
atcacataccatattaaagtgaaattttatgtagctttgtattctttttgacttgtatactataccccttaaatgtagtcatatatggactttgtcttcc |
33847666 |
T |
 |
| Q |
318 |
ttgctttaggagtcaaatggaccctatg |
345 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
33847667 |
ttgctttaggagtcaaatggaccctatg |
33847694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University