View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6275_high_2 (Length: 439)
Name: NF6275_high_2
Description: NF6275
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6275_high_2 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 363; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 363; E-Value: 0
Query Start/End: Original strand, 13 - 425
Target Start/End: Original strand, 52477964 - 52478367
Alignment:
| Q |
13 |
aatattcacgtgagatatatatggtatagaagaaagtcatgatatatatggccgaccagcactaaattaaaatttgaaacatgaagttccactttgaaat |
112 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52477964 |
aatattcacgtgagatat----ggtatagaagaaagtcatgatatatatggccgaccagcactaaattaaaatttgaaacatgaagttccactttgaaat |
52478059 |
T |
 |
| Q |
113 |
agaagtgggagaatgcgtaagcccttgtcaagatatttgataacttgtccaatcatgcttcataatcataattcatacattattaattaacgatcaaatt |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
52478060 |
agaagtgggagaatgcgtaagcccttgtcaagatatttgataacttgtccaatcatgcttcataatcataattcatacatt----attaacgatcaaatt |
52478155 |
T |
 |
| Q |
213 |
aacattagatagtcatggtcatgagtgacgccatgccattgttgacggcctattagcaactggtctagaactgttgttattctcagtggacatttacacc |
312 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52478156 |
aacattagatagtcatggtcatgagtgacgccatgccattgttgacggcctattagcaactggtctagaactgttgttattctcagtggacatttacacc |
52478255 |
T |
 |
| Q |
313 |
atcactttaccgttttttatttgtataagttaattataacggtgatcttttttaatattgtcggttctcaagtcatcatggctttattagagatgttacc |
412 |
Q |
| |
|
||||||||||| ||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52478256 |
atcactttacc-tttattatttgtataagtaaattataacggtgatcttttttaatattgtcggttctcaagtcatcatggctttattagagatgttacc |
52478354 |
T |
 |
| Q |
413 |
cacggttcaattt |
425 |
Q |
| |
|
||||||||||||| |
|
|
| T |
52478355 |
cacggttcaattt |
52478367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University