View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6276_high_21 (Length: 232)
Name: NF6276_high_21
Description: NF6276
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6276_high_21 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 1 - 213
Target Start/End: Complemental strand, 47836854 - 47836642
Alignment:
| Q |
1 |
taaaaaatatagaagcaggtaatatttgacccttgtgtgtgcaatatcttacgttttaagtatctctgtcaagaatgggaacattttctcaagcttttct |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
47836854 |
taaaaaatatagaagcaggtaatatttgacccttgtgtgtgcaatatcttacgttttaagtatctctgtcaggaatgggaacattttctcaagcttttca |
47836755 |
T |
|
| Q |
101 |
ggttgagtcaagccttgtacaaatgtgacaggggcgaggaatacaatcatgaaggtggtagaaaccccccatgtgaatatctttcgaagccatagttgtc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47836754 |
ggttgagtcaagccttgtacaaatgtgacaggggcgaggaatacaatcatgaaggtggtagaaaccccccatgtgaatatctttcgaagccatagttgtc |
47836655 |
T |
|
| Q |
201 |
tgtatgggatgca |
213 |
Q |
| |
|
||||||||||||| |
|
|
| T |
47836654 |
tgtatgggatgca |
47836642 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 48 - 120
Target Start/End: Original strand, 4706681 - 4706753
Alignment:
| Q |
48 |
cttacgttttaagtatctctgtcaagaatgggaacattttctcaagcttttctggttgagtcaagccttgtac |
120 |
Q |
| |
|
||||| ||||||||| | ||| || || ||||||||||||| ||| |||||| ||||||||||||||||||| |
|
|
| T |
4706681 |
cttactttttaagtacccctgccagaaaagggaacattttctgaagtttttctagttgagtcaagccttgtac |
4706753 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University