View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6276_low_16 (Length: 303)
Name: NF6276_low_16
Description: NF6276
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6276_low_16 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 273; Significance: 1e-152; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 273; E-Value: 1e-152
Query Start/End: Original strand, 13 - 285
Target Start/End: Original strand, 55162503 - 55162775
Alignment:
| Q |
13 |
aaaatcatagctagagggcacaatatattctgggaagaccctaaatacaatcctgcatgggttcttaaccttacaggtacacagttaagatctgctgtga |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55162503 |
aaaatcatagctagagggcacaatatattctgggaagaccctaaatacaatcctgcatgggttcttaaccttacaggtacacagttaagatctgctgtga |
55162602 |
T |
 |
| Q |
113 |
attcacgaattcaaagtctcatgaaccaatacaaaacagaattcatacattgggatatcagtaacgaaatgcttcattttgatttctacgaacaaaggct |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55162603 |
attcacgaattcaaagtctcatgaaccaatacaaaacagaattcatacattgggatatcagtaacgaaatgcttcattttgatttctacgaacaaaggct |
55162702 |
T |
 |
| Q |
213 |
tggacccaatgctacatttcatttctttgaggcagcacatgaatcagatcctctagcaactctgtttatgaat |
285 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55162703 |
tggacccaatgctacatttcatttctttgaggcagcacatgaatcagatcctctagcaactctgtttatgaat |
55162775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University