View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6276_low_24 (Length: 218)
Name: NF6276_low_24
Description: NF6276
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6276_low_24 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 141; Significance: 4e-74; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 141; E-Value: 4e-74
Query Start/End: Original strand, 1 - 157
Target Start/End: Original strand, 17006195 - 17006351
Alignment:
| Q |
1 |
atatatcagtacattgttaggtatttgtgtctatgtcggtgcttcatagattaagcaagtaatttttcttatataattaataatgatcaaaccatgttta |
100 |
Q |
| |
|
||||||||||||||| |||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
17006195 |
atatatcagtacatttttaggtatttttgtctatgtcggtgctttatagattaagcaagtaatttttcttatataaataataatgatcaaaccatgttta |
17006294 |
T |
 |
| Q |
101 |
tcacaagggtgcaaataatgcctacttaactgcttttgtttagtatcaggtgtagca |
157 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17006295 |
tcacaagggtgcaaataatgcctacttaactgcttttgtttagtatcaggtgtagca |
17006351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 156 - 207
Target Start/End: Original strand, 17006420 - 17006471
Alignment:
| Q |
156 |
catatcttgagaaaatgaaaagaatgcgaatatagttaactagtattatcta |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
17006420 |
catatcttgagaaaatgaaaagaatgcgaatatagttaactagtactatcta |
17006471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 3 - 58
Target Start/End: Original strand, 16975526 - 16975581
Alignment:
| Q |
3 |
atatcagtacattgttaggtatttgtgtctatgtcggtgcttcatagattaagcaa |
58 |
Q |
| |
|
||||||||| | ||| | ||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
16975526 |
atatcagtatagtgtcaagtatttgtgtctatgccggagcttcatagattaagcaa |
16975581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University