View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6276_low_9 (Length: 372)
Name: NF6276_low_9
Description: NF6276
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6276_low_9 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 309; Significance: 1e-174; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 309; E-Value: 1e-174
Query Start/End: Original strand, 1 - 359
Target Start/End: Complemental strand, 40716177 - 40715809
Alignment:
| Q |
1 |
tctttgtctcattttcttgtcaaaaccttcttactttgctttctttcttcattcactcaccnnnnnnngtgtaacgttatgatcatggccaaatgattca |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
40716177 |
tctttgtctcattttcttgtcaaaaccttcttactttgctttctttcttcattcactcacctttttttgtgtaacgttatgatcatggccaaatgattca |
40716078 |
T |
|
| Q |
101 |
ttaggattggtttttgtaagttgtttataaagaaaactagttaacatgggttcttcttcaaaagttggaaatagtaactatgattactcttttaaggttt |
200 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40716077 |
ttaggattggtttttgtaagttgttgataaagaaaactagttaacatgggttcttcttcaaaagttggaaatagtaactatgattactcttttaaggttt |
40715978 |
T |
|
| Q |
201 |
tgttgattggtgattctggtgttggcaagagtagtcttcttctcagctttatctctaatgctaactcacttgatgacctttctcccactattggttctc- |
299 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40715977 |
tgttgattggtgattctggtgttggcaagagtagtcttcttctcagctttatctctaatgctaactcacttgatgacctttctcccactattggttctct |
40715878 |
T |
|
| Q |
300 |
---------ttctttccttttactttttctttctagtttctactatatatcatcatttgtgttagagaa |
359 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40715877 |
tctcttctcttctttccttttactttttctttctagtttctactatatatcatcatttgtgttagagaa |
40715809 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 204 - 246
Target Start/End: Original strand, 39223599 - 39223641
Alignment:
| Q |
204 |
tgattggtgattctggtgttggcaagagtagtcttcttctcag |
246 |
Q |
| |
|
||||||| ||||||||||||||||| ||||||||||||||||| |
|
|
| T |
39223599 |
tgattggggattctggtgttggcaaaagtagtcttcttctcag |
39223641 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 191 - 225
Target Start/End: Complemental strand, 4375101 - 4375067
Alignment:
| Q |
191 |
tttaaggttttgttgattggtgattctggtgttgg |
225 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||| |
|
|
| T |
4375101 |
tttaaggttgtgttgattggtgattctggtgttgg |
4375067 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University