View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6277_high_47 (Length: 300)
Name: NF6277_high_47
Description: NF6277
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6277_high_47 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 273; Significance: 1e-152; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 273; E-Value: 1e-152
Query Start/End: Original strand, 8 - 300
Target Start/End: Original strand, 53128158 - 53128450
Alignment:
| Q |
8 |
gagcacagatgcgtaagataggtgacaaatttctatttcatagatgttatgacttacaaatgatacgatacatcaactaatggggtctccaaatgagtgg |
107 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
53128158 |
gagcccagatgcgtaagataggtgacaaatttctatttcatagatgttatgacttacaaatgatatgatacatcaactaatggggtctccaaatgagtgg |
53128257 |
T |
 |
| Q |
108 |
cgaccacatagacctgaagctggagattttggaagccaaaaccaaaagcaacaccaccagcgccgcgacgccccaaggtgacgatcctcctccttctgtt |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
53128258 |
cgaccacatagacctgaagctggagattttggaagccaaaaccaaaagcaacaccaccagcgccgcaacgccccaaggtgacgatcctcctccttctgtt |
53128357 |
T |
 |
| Q |
208 |
tgtgtgcgtgattgtattaaccgtcgaccaaagaaatccacctgaattacaaaccgtggcccgcatttggagatgaagtatgcaataaaaatc |
300 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53128358 |
tgtgcgcgtgattgtattaaccgtcgaccaaagaaatccaccggaattacaaaccgtggcccgcatttggagatgaagtatgcaataaaaatc |
53128450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University