View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6277_high_67 (Length: 256)
Name: NF6277_high_67
Description: NF6277
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6277_high_67 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 158; Significance: 4e-84; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 158; E-Value: 4e-84
Query Start/End: Original strand, 59 - 256
Target Start/End: Complemental strand, 1581677 - 1581480
Alignment:
| Q |
59 |
ttagtagccaagaacaataatgacaactttgaagccctaattagattcattggaaatggagagggtctaaaaatactctcttcttattgttcatattttt |
158 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
1581677 |
ttagtggccaagaacaataatgacaactttgaagctctaattagattcattggaaatggagagggtctaaaaatactctcttctgattgttcatattttt |
1581578 |
T |
 |
| Q |
159 |
cctctacattaaacctaatgttgccttagctataaacaatttactgcatgccccagttacaaacaaaaacctcatcagtgttaacagctttactaaaa |
256 |
Q |
| |
|
|| |||||||||||||||||| ||||| ||||||||||||||||||||||||||| ||| ||||||||||||||||||||| |||| ||||||||||| |
|
|
| T |
1581577 |
cccctacattaaacctaatgtcgccttggctataaacaatttactgcatgccccaattataaacaaaaacctcatcagtgtcaacaactttactaaaa |
1581480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University