View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6277_high_71 (Length: 251)
Name: NF6277_high_71
Description: NF6277
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6277_high_71 |
 | |
|
| [»] scaffold0028 (2 HSPs) |
| | |
|
Alignment Details
Target: scaffold0028 (Bit Score: 195; Significance: 1e-106; HSPs: 2)
Name: scaffold0028
Description:
Target: scaffold0028; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 13 - 240
Target Start/End: Complemental strand, 121756 - 121529
Alignment:
| Q |
13 |
ctatcaaccttaattatgtctattggtttctaactatgtctcaaaaccataaccaatcatannnnnnngaaatgatgacattttatagtaatcatgacat |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||| |
|
|
| T |
121756 |
ctatcaaccttaattatgtctattggtttctaactatgtctcaaaaccataaccaaacatatttttttgaaatgatgacattttatagtaatcatgacat |
121657 |
T |
|
| Q |
113 |
agtacaatgttatatcaactagctattaacatatcaaatcaattatatatgtacctatttaaataatttaattactcatgatctatttacctacttgaac |
212 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
121656 |
agtacaatgttgtatcaactagctattaacatatcaaatcaattatatatgtacctatttaaataatttaattactcatgatctatttacctacttgaac |
121557 |
T |
|
| Q |
213 |
agttctatctaatctaaacttctcctat |
240 |
Q |
| |
|
|| ||||||||||||||||||||||||| |
|
|
| T |
121556 |
aggtctatctaatctaaacttctcctat |
121529 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0028; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 16 - 71
Target Start/End: Complemental strand, 121879 - 121823
Alignment:
| Q |
16 |
tcaaccttaattatgtctattggtttctaactatgtctc-aaaaccataaccaatca |
71 |
Q |
| |
|
|||||||||||| | ||||||||||||||||| |||||| ||||| ||||||||||| |
|
|
| T |
121879 |
tcaaccttaattctatctattggtttctaactttgtctcaaaaactataaccaatca |
121823 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University