View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6277_high_73 (Length: 251)
Name: NF6277_high_73
Description: NF6277
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6277_high_73 |
 |  |
|
| [»] chr5 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 237; Significance: 1e-131; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 11 - 251
Target Start/End: Original strand, 15401928 - 15402168
Alignment:
| Q |
11 |
aagaatatgtaacacgcaagttttatgaataatgaacacttagcaccaaggttttaaattggtggaagtcatgtgacggttcttgacattgaggagaatc |
110 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15401928 |
aagaaaatgtaacacgcaagttttatgaataatgaacacttagcaccaaggttttaaattggtggaagtcatgtgacggttcttgacattgaggagaatc |
15402027 |
T |
 |
| Q |
111 |
acgatcaaatgcagctgacgcagactcaatcgtattcacattgcaatttgcaatgaattctcttttatcaaaacctggtctgacacctttattaatacaa |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15402028 |
acgatcaaatgcagctgacgcagactcaatcgtattcacattgcaatttgcaatgaattctcttttatcaaaacctggtctgacacctttattaatacaa |
15402127 |
T |
 |
| Q |
211 |
tttactttgttattgttttttagtaatttactctaaactct |
251 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15402128 |
tttactttgttattgttttttagtaatttactctaaactct |
15402168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 143 - 189
Target Start/End: Original strand, 15400123 - 15400169
Alignment:
| Q |
143 |
tattcacattgcaatttgcaatgaattctcttttatcaaaacctggt |
189 |
Q |
| |
|
||||||||||||||||||||||||| | ||| |||| |||||||||| |
|
|
| T |
15400123 |
tattcacattgcaatttgcaatgaaatatctcttattaaaacctggt |
15400169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University