View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6277_high_78 (Length: 245)
Name: NF6277_high_78
Description: NF6277
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6277_high_78 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 58; Significance: 2e-24; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 133 - 211
Target Start/End: Complemental strand, 40319263 - 40319181
Alignment:
| Q |
133 |
aaagataaaagactcctacaaactgaaataaaatttata----ctactcatgacgcacttgaatcaatctctaaatgtgatta |
211 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40319263 |
aaagataaaagactccaacaaactgaaataaagtttatatatactactcatgacgcacttgaatcaatctctaaatgtgatta |
40319181 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University