View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6277_high_85 (Length: 239)
Name: NF6277_high_85
Description: NF6277
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6277_high_85 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 180; Significance: 2e-97; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 9397913 - 9397695
Alignment:
| Q |
1 |
cctcataaccgaagaaaaatttctgcaacaaaaatggataggactactttctggtgcggatgaagattaccctttagacaacttccgttttccttgtcgc |
100 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9397913 |
cctcataacggaagaaaaatttctgcaacaaaaatggataggactactttctggggcggatgaagattaccctttagacaacttccgttttccttgtcgc |
9397814 |
T |
 |
| Q |
101 |
ctcgacattatattgaagtttcttagttccttgactacttccaa-ttctttgatctggaccttttacttgagaaaactctaggaaccatcttttaactcg |
199 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
9397813 |
ctcgac-----attgaagtttcttagttccttgactacttccaatttgtttgatctggaccttttacttgagaaaactctaggaaccatcttttaacgcg |
9397719 |
T |
 |
| Q |
200 |
tcaaaatgaacgcactttgcttgt |
223 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
9397718 |
tcaaaatgaacgcactttgcttgt |
9397695 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 52 - 109
Target Start/End: Complemental strand, 9396989 - 9396932
Alignment:
| Q |
52 |
tggtgcggatgaagattaccctttagacaacttccgttttccttgtcgcctcgacatt |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
9396989 |
tggtgcggatgaagattaccctttagacaacttatgttttccttgtcgcctcaacatt |
9396932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University