View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6277_high_86 (Length: 239)
Name: NF6277_high_86
Description: NF6277
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6277_high_86 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 15 - 221
Target Start/End: Complemental strand, 12508555 - 12508349
Alignment:
| Q |
15 |
acagacggtacaacaccatgcagtgatgatcaaggattagtatcatcaccacaaacaaatgaagcaaaaaacagtttaacttttgcttcattgaaagcaa |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12508555 |
acagacggtacaacaccatgcagtgatgatcaaggattagtatcatcaccacaaacaaatgaagcaaaaaacagtttaacttttgcttcattgaaagcaa |
12508456 |
T |
 |
| Q |
115 |
aattgagcaagaatcttcaaagtattatggcaagaacaagtgatcatcataacaacaagttttcaaagagtagagtgagtgatcattttacttttgctag |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12508455 |
aattgagcaagaatcttcaaagtattatggcaagaacaagtgatcataataacaacaagttttcaaagagtagagtgagtgatcattttacttttgctag |
12508356 |
T |
 |
| Q |
215 |
catattc |
221 |
Q |
| |
|
||||||| |
|
|
| T |
12508355 |
catattc |
12508349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University