View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6277_high_89 (Length: 238)
Name: NF6277_high_89
Description: NF6277
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6277_high_89 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 17 - 238
Target Start/End: Original strand, 40383406 - 40383627
Alignment:
| Q |
17 |
atttgcaaaagtggcaactgaggacgcaattgagttaccgtttccattaccaccattagttcctgagactaatttccctcttgagatactggcactgatg |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
40383406 |
atttgcaaaagtggcaactgaggacgcaattgagttaccgttgccattaccaccgttagttcctgagactaatttccctcttgagatactcgcactgatg |
40383505 |
T |
 |
| Q |
117 |
gcgtcttttaacgacattttaggtccgttaacggcagttacagatgctggtttatactttaactgccatgacttgttgaactctacaaggctttttgttc |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40383506 |
gcgtcttttaacgacattttaggtccgttaacggcagttacagatgctggtttatactttaactgccatgacttgttgaactctacaaggctttttgttc |
40383605 |
T |
 |
| Q |
217 |
ctccgggagtctcttcaagctc |
238 |
Q |
| |
|
|||||||| | ||||||||||| |
|
|
| T |
40383606 |
ctccgggattttcttcaagctc |
40383627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University