View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6277_high_91 (Length: 235)
Name: NF6277_high_91
Description: NF6277
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6277_high_91 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 1 - 219
Target Start/End: Complemental strand, 4685371 - 4685153
Alignment:
| Q |
1 |
tgattgccatcttgccggagccttaggattgcttagagttcttgtatacaaggtacatttgctacacctctatcttgaatacacctttttcttttctttt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4685371 |
tgattgccatcttgccggagccttaggattgcttagagttctcgtatacaaggtacatttgctacacctctatcttgaatacacctttttcttttctttt |
4685272 |
T |
|
| Q |
101 |
cggaaagacatatattagtggttaatagccagggtttgaacaccggactttcttctcaaactcatttcattgttcaagtttgaccacttgagctacgact |
200 |
Q |
| |
|
||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
4685271 |
cggaaagacatatattagttgttaatagctagggtttgaacaccggactttcttctcaaactcatttcattgttcaagttcgaccacttgagctacgact |
4685172 |
T |
|
| Q |
201 |
tgatgaacaatggaaatag |
219 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
4685171 |
tgatgaacaatggaaatag |
4685153 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University