View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6277_low_39 (Length: 339)
Name: NF6277_low_39
Description: NF6277
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6277_low_39 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 169; Significance: 1e-90; HSPs: 5)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 47 - 320
Target Start/End: Original strand, 44681727 - 44682003
Alignment:
| Q |
47 |
aagtgtttatatgaaatgatttgaatttcttgcatgataaaattatcatcctcatactttgcaatttttattc----tgtgttgataatgttttgaaaca |
142 |
Q |
| |
|
|||||||||| | ||||||||||| ||||||||||||| |||| ||||||||||| |||| | | | |||| |||| ||||| | |||| || || |
|
|
| T |
44681727 |
aagtgtttattcggaatgatttgaaattcttgcatgatacaattctcatcctcataatttgtattctgtattgatgatgtgctgata-tattttcaagca |
44681825 |
T |
|
| Q |
143 |
ttgcagtgaaaagaaaatggggaatcttatgtgttgcgtgcaagttgatcaatctcaagtggctatgaaagaaggttttgggaaatttgaaaaggtgctt |
242 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
44681826 |
ttgcagtgaaaagaaaatggggaatcttgtgtgttgtgtgcaagttgatcaatctcaagtggctatgaaagaaggttttggaaaatttgaaaaggtgctt |
44681925 |
T |
|
| Q |
243 |
cagccgggatgccattgcatgccatggttccttggaaaacgaattgccggtcatctctctcttcggctacaacaattg |
320 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||| |
|
|
| T |
44681926 |
cagccgggatgccattgcatgccatggttccttggaaaacgaattgctggtcatctctctcttcgggtacaacaattg |
44682003 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 160; E-Value: 3e-85
Query Start/End: Original strand, 133 - 320
Target Start/End: Original strand, 44652802 - 44652989
Alignment:
| Q |
133 |
ttttgaaacattgcagtgaaaagaaaatggggaatcttatgtgttgcgtgcaagttgatcaatctcaagtggctatgaaagaaggttttgggaaatttga |
232 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
44652802 |
ttttgaagcattgcagtgaaaagaaaatggggaatcttgtgtgttgtgtgcaagttgatcaatctcaagtggctatgaaagaaggttttggaaaatttga |
44652901 |
T |
|
| Q |
233 |
aaaggtgcttcagccgggatgccattgcatgccatggttccttggaaaacgaattgccggtcatctctctcttcggctacaacaattg |
320 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||| ||||||||||| |
|
|
| T |
44652902 |
aaaggtgcttcagccgggatgccattgcatgccatggttccttggaaaaagaattgctggtcatctctctcttcgggtacaacaattg |
44652989 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 156; E-Value: 8e-83
Query Start/End: Original strand, 145 - 320
Target Start/End: Original strand, 44691502 - 44691677
Alignment:
| Q |
145 |
gcagtgaaaagaaaatggggaatcttatgtgttgcgtgcaagttgatcaatctcaagtggctatgaaagaaggttttgggaaatttgaaaaggtgcttca |
244 |
Q |
| |
|
||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44691502 |
gcagtgaaaagaaaatggggaatattgtgtgttgcgtgcaagttgatcaatctcaagtggctatgaaagaaggttttgggaaatttgaaaaggtgcttca |
44691601 |
T |
|
| Q |
245 |
gccgggatgccattgcatgccatggttccttggaaaacgaattgccggtcatctctctcttcggctacaacaattg |
320 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||| |
|
|
| T |
44691602 |
tccgggatgccattgcatgccatggttccttggaaaacgaattgccggtcatctctctcttcgggttcaacaattg |
44691677 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 136; E-Value: 7e-71
Query Start/End: Original strand, 133 - 320
Target Start/End: Complemental strand, 44637528 - 44637341
Alignment:
| Q |
133 |
ttttgaaacattgcagtgaaaagaaaatggggaatcttatgtgttgcgtgcaagttgatcaatctcaagtggctatgaaagaaggttttgggaaatttga |
232 |
Q |
| |
|
|||||||| ||||||| |||||||||||||||||||| ||||||| |||||||||||||||||| ||||||||||||||| |||||||| |||||||| |
|
|
| T |
44637528 |
ttttgaaatgttgcagttaaaagaaaatggggaatcttttgtgttgtgtgcaagttgatcaatctacagtggctatgaaagagggttttggaaaatttga |
44637429 |
T |
|
| Q |
233 |
aaaggtgcttcagccgggatgccattgcatgccatggttccttggaaaacgaattgccggtcatctctctcttcggctacaacaattg |
320 |
Q |
| |
|
| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
44637428 |
agaggtgcttcagccaggatgccattgcatgccatggttccttggaaaacgaattgctggtcatctctctcttcggctacagcaattg |
44637341 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 135; E-Value: 3e-70
Query Start/End: Original strand, 138 - 320
Target Start/End: Original strand, 44631319 - 44631501
Alignment:
| Q |
138 |
aaacattgcagtgaaaagaaaatggggaatcttatgtgttgcgtgcaagttgatcaatctcaagtggctatgaaagaaggttttgggaaatttgaaaagg |
237 |
Q |
| |
|
|||||||||||| ||||| |||||||||||||| |||||||||||||||||||||| ||| |||||||||| |||||||||||| ||||||||| ||| |
|
|
| T |
44631319 |
aaacattgcagttaaaagcaaatggggaatcttttgtgttgcgtgcaagttgatcagtctacggtggctatgagagaaggttttggaaaatttgaagagg |
44631418 |
T |
|
| Q |
238 |
tgcttcagccgggatgccattgcatgccatggttccttggaaaacgaattgccggtcatctctctcttcggctacaacaattg |
320 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
44631419 |
tgcttcagccaggatgccattgcatgccatggttccttggaaaacgaattgccggtcatctctcccttcggctacaacaattg |
44631501 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University