View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6277_low_62 (Length: 264)
Name: NF6277_low_62
Description: NF6277
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6277_low_62 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 145; Significance: 2e-76; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 58 - 242
Target Start/End: Complemental strand, 25324304 - 25324120
Alignment:
| Q |
58 |
aaatcgacatctaagattttgagagaagcatactctaaagtctcaagctaagatcatcggaccaactcaagtggatataattaaacggactgttaaatct |
157 |
Q |
| |
|
||||||||| |||||| |||||||| |||||||||||||||||||| |||||| ||||| | |||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
25324304 |
aaatcgacacctaagactttgagaggagcatactctaaagtctcaaactaagaccatcgaatcaactcaagtgggtataattaaacggactgttaaatct |
25324205 |
T |
|
| Q |
158 |
tcttcatacaaagataattgtcggaattaagatatagtctgaaattaagatttaatctttggtcctttaaggtgtatgagttagg |
242 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25324204 |
tcttcatacaaagataattttcggaattaagatttagtctgaaattaagatttaatctttggtcctttaaggtgtatgagttagg |
25324120 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 31
Target Start/End: Complemental strand, 25324370 - 25324340
Alignment:
| Q |
1 |
aaattaatactttttatcttaaataaatgga |
31 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
25324370 |
aaattaatactttttatcttaaataaatgga |
25324340 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 84 - 131
Target Start/End: Complemental strand, 26061738 - 26061691
Alignment:
| Q |
84 |
agcatactctaaagtctcaagctaagatcatcggaccaactcaagtgg |
131 |
Q |
| |
|
|||||||||| |||||||||||||| |||||| |||||||||| |||| |
|
|
| T |
26061738 |
agcatactctcaagtctcaagctaatatcatcagaccaactcatgtgg |
26061691 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University