View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6277_low_77 (Length: 248)
Name: NF6277_low_77
Description: NF6277
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6277_low_77 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 1 - 215
Target Start/End: Original strand, 33511957 - 33512171
Alignment:
| Q |
1 |
acgcggacatatgcattagcctttaatgttgcaagtcattgcgtctaatgttgggacttgatcgagggatataattgaattaaattgagagagaaatatg |
100 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33511957 |
acgcggacgtatgcattagcctttaatgttgcaagtcattgcgtctaatgttgggacttgatcgagggatataattgaattaaattgagagagaaatatg |
33512056 |
T |
 |
| Q |
101 |
gannnnnnnaaaaacttcaaaggcaaaagttgtcgaatccatgtaaattcaaggagaaaatggcttattcattaaataaaagcaacaattatatgtatcc |
200 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
33512057 |
gattttttaaaaaacttcaaaggcaaaagttgtcgaatccatgtaaattcaagaagaaaatggcttattcattaaataaaagtaacaattatatgtatgt |
33512156 |
T |
 |
| Q |
201 |
ctctacatgacatca |
215 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
33512157 |
ctctacatgacatca |
33512171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University