View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6277_low_94 (Length: 233)
Name: NF6277_low_94
Description: NF6277
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6277_low_94 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 1 - 217
Target Start/End: Complemental strand, 38001117 - 38000901
Alignment:
| Q |
1 |
tgacatcttatcatggcaagaactagttggtgcaggccccattcgaattgcagaaggtgaagtttggtgattgttacaatttaccaaatgaattacctca |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38001117 |
tgacatcttatcatggcaagaactagttggttcaggccccattcgaattgcagaaggtgaagtttggtgattgttacaatttaccaaatgaattacctca |
38001018 |
T |
 |
| Q |
101 |
gttggaataccaaatataatttttgagatgaatcgtaaacatgtagttggtgatggcgcagctaaaacagttacaccataaaatggctcactcataatta |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
38001017 |
gttggaataccaaatataatttttgagatgaatcgtaaacatgtagttggtgatggcgcagctaaaacagttagaccataaaatggctcactcataatta |
38000918 |
T |
 |
| Q |
201 |
attttgtaccatacttg |
217 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
38000917 |
tttttgtaccatacttg |
38000901 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University